G. Meschersky, A. D. Chernetsky, V. V. Krasnova, B. A. Solovyev, D. A. Udovik, O. V. Shpak, D. M. Glazov, and V. V. Rozhnov

The article was published in the Biology Bulletin of the Russian Academy of Sciences, Issue No. 2, 2018

Abstract The data on mtDNA sequences of the beluga whale (Delphinapterus leucas) from the central East-ern Arctic as well as coastal waters of the Chukchi Peninsula and different parts of the White Sea are presented and analyzed for the first time. Certain sequences found in the region form a separate phylogenetic clade. The distinctness of composition of maternal lineages found for the White Sea is noted. However, the set of sequences found in the Russian Arctic in whole cannot be characterized as region-specific.

INTRODUCTION

The distribution range of the beluga whale Delphi-napterus leucas is limited by the cold and, partially, moderate regions of the Northern Hemisphere. Belu-gas inhabit all Arctic seas. Studies of the genetic struc-ture of beluga populations in the Sea of Okhotsk, North Pacific, and adjacent Arctic regions, as well as the Canadian Arctic, demonstrate that this cetacean species is characterized by a high degree of philopatry. Stable beluga aggregations occupy different summer feeding grounds. On the contrary, some separate pop-ulations, which differ not only by the composition of mitochondrial lineages, but also by nuclear (recom-bining) genetic markers, can occur in a single region (Brown Gladden et al., 1997, 1999; O’Corry-Crowe et al., 1997, 2010; de March et al., 2002; de March and Postma 2003; Meschersky et al., 2008, 2013; Turgeon et al., 2012; Colbeck et al., 2013).

The Eastern Arctic, being a substantial part of the beluga range, is characterized by extended barrier-free aquatic area over which the seasonal ice conditions can vary significantly in different years. On one hand, it should allow for much more extensive and longer seasonal migration routes and, on the other, interfere with use of the same routes from year to year. Such conditions evidently may affect the beluga population structure. At the same time, genetic studies of beluga whales that populate the Eastern Arctic are extremely scarce (O’Corry-Crowe et al., 2010), and for the terri-torial waters of Russia, they have been absent to date.

In the spring–autumn, in the territorial waters of Russia, belugas are regularly encountered in the Bar-ents, Laptev, Kara, and Chukchi seas, as well as in the northern Bering Sea. Single encounters were recorded in the East Siberian Sea and in the high Arctic lati-tudes. In the winter, at maximum ice extent, belugas can also be encountered in all of these regions. How-ever, the greatest number of winter registrations occur in the waters of the Barents Sea in the west, as well as in the western Chukchi Sea and the northwestern areas of the Bering Sea in the east. The winter encounters of beluga whales in the Kara and Laptev seas are extremely rare (Belikov et al., 2002; Matishov and Ognetov, 2006; Lukin and Ognetov, 2009). Based on this fact, the common opinion is that beluga whales of the Barents, Kara, and Laptev seas, as well as, at least partially, the White Sea, belong to a single population (“Barents Sea population” according to the main location of wintering), while more eastern regions and the White Sea should be primarily regarded as summer feeding grounds (Belikov et al., 2002; Matishov and Ognetov, 2006; Lukin and Ognetov, 2009).

The opposite opinion, presupposing the existence of separate populations of beluga whales occuring in the Kara, Laptev, and White seas the year-round (Kleinenberg et al., 1964; Berzin and Yablokov, 1978), is agreed upon by minor number of researchers, although the year-round stay of beluga whales at least in the White Sea has recently been confirmed with the use of satellite tagging (Kuznetsova et al., 2016). The hypothesis (Kochnev, 2003) about the connection of the belugas encountered in the Russian part of the Chukchi Sea and the belugas of the eastern part of this sea, the Beaufort Sea, and northeast of the Bering Sea (BCB region) is currently considered obvious. Never-theless, the population structure of beluga whales inhabiting the Russian part of the Eastern Arctic can be clarified only by using satellite tagging and popula-tion genetic analysis.

The genetic characteristics of the beluga whales of the Eastern Arctic is also important for understanding of formation of the species global population structure in the postglacial period. The mitochondrial DNA (mtDNA) of beluga whales is characterized by low variability, and it greatly complicates determination of phylogenetic relationships. Previously, based on anal-ysis of sequences of a short fragment of the control region, the substantial distance between mitochon-drial lineages common to a number of beluga whales from the mouth of St. Lawrence River and the Eastern Canadian Arctic was demonstrated (Brown Gladden et al., 1997; de March and Postma, 2003). Later, a pronounced separation of the phylogroup, which includes the belugas from off the western coast of Kamchatka Peninsula in the Sea of Okhotsk and some individuals from the Anadyr Estuary, as well as separa-tion of the other mitochondrial lineages known for the Sea of Okhotsk and the North Pacific into two groups, were demonstrated (Meschersky et al., 2013). The existence of the two latter clades, however, was not supported, and the ancestral sequences could not be revealed when attempting a combined analysis of all currently known haplotypes. There is a hope that future study of the genetic diversity of Eastern Arctic belugas reveals earlier unknown variants, and this would increase the phylogenetic signal and help to define the phylogeographic structure of the species.

However, the organization of the sample collection (biopsying) of beluga whales in the Arctic seas for the extended genetic analysis requires significant costs and is unlikely to be accomplished soon. For several years, we have collected a certain amount of beluga tissue samples from the White Sea, the coast of the Chukchi Peninsula, and the coasts of the Kara and Laptev seas.The mtDNA sequences were obtained for these samples.

The goal of the present study is to present and dis-cuss the data as the first results of genetic research on beluga whales of the Russian Arctic.

MATERIALS AND METHODS

The material from the White Sea was represented by 48 individuals, including biopsy samples from 20 males from the mouth of the Varzuga River (southern coast of the Kola Peninsula, collection period October 2010–2012), 18 females and one male from the Solovetskiy nursery aggregation (Chernetsky et al., 2002) off Cape Beluzhiy of Solovetskiy Island in northern part of Onezhskiy Bay (July–August, 2011– 2016), four individuals (two males, two females), biopsied or found dead at different times in other parts of Onezhskiy Bay (near Cape Glubokiy and on Parus-niy, Osinki, and Zhizhginskiy islands), and five beluga whales from Dvinskiy Bay (summer of 2012, four females biopsied near Golaya Koshka Island, and a dead male found on Muravoy Island).

Material from the coast of the Chukchi Peninsula was represented by ten individual samples (nine males and one female) obtained during the autumn–winter period (two individuals: September–October, eight individuals: November–January) in 2011–2012 in the Senyavin Strait, as well as in the villages in different parts of the coast: Uelen, Lorino, Sireniki, and Nurli-gran.

In the course of analysis of samples of belugas from the coast of the Chukchi Peninsula, we also analyzed, as the comparative material, the samples from the coast of Alaska kindly provided by the Mammal Genomic Resources Collection (University of Alaska Museum of the North): two individuals from the Beaufort Sea (UAM:Mamm: 76608, 86886), ten indi-viduals from the eastern Chukchi Sea (UAM:Mamm: 52221–25, 70322–26), three individuals from off Little Diomede Island (UAM:Mamm: 66416, 98081–82), eight samples from Norton Sound (UAM:Mamm: 70515, 70519-20, 70522–23, 70525, 75728, and 118801), and six samples from Bristol Bay (UAM: Mamm: 63039, 66633, 83385, 87025, 91765, and 99603). MtDNA sequences obtained for these samples were deposited into NCBI GenBank under accession numbers MF919064-121. We also determined the sequences of the cytochrome b gene for a number of individuals from the earlier presented sample set col-lected in the Anadyr Estuary (Meschersky et al., 2013).

The samples from the central Russian Arctic were represented exclusively by remains of dead animals. In the region of Yenisei Gulf (the Kara Sea), five individ-uals that died in 2012–2015; nine individuals whose remains were found at the site of the beluga whaling station of 1980–1990, and five individuals found at the site of the beluga whaling station of 1940–1960 were analyzed. Material from animals that died more than 20 years ago was represented by teeth and ear bones found at least a few dozen meters apart, which makes it unlikely that they belonged to the same individual. Teeth from two animals found dead on the Nor-denskiöld Archipelago (the Kara Sea) and at the mouth of the Olenek River (the Laptev Sea) were also analyzed.

DNA from the skin samples collected by the method of live biopsy or from recently died animals was extracted using an InviMag Tissue DNA kit/KF96 (Stratec Molecular, Germany) on the processor of the KingFisher Flex magnetic particles (ThermoScien-tific, Finland). DNA from tissue samples of animals that died a few years ago was isolated by Diatom DNA Prep (Isogen, Russia) and from older samples—by the QIAamp DNA Investigator Kit (Qiagen, Germany). For the isolation of DNA from the bones aged more than 20 years, NucleoSpin DNA Trace was used in combination with the NucleoSpin DNA Trace Bone Buffer Set (Macherey-Nagel, Germany).

Amplification was conducted on the extracted DNA with the subsequent sequencing by the Sanger method (AB Analyzer 3500, with BigDye Terminator ReadyReaction kit v. 3.1 (ThermoFisher Scientific, United States)).

For well-preserved samples (the White Sea and the coast of the Chukchi Peninsula), the following sequences were determined: 62 base pairs (bp) sequence of the tRNA-Pro gene and 497–542 bp sequence of the control region with the use of external (L15926 and H00034) (O’Corry-Crowe et al., 1997) and internal (beluga_F1int: acaca-caccattaaatcttagtctt and beluga_R1int: ttaagctcgt-gatctaatggag) primers. The minimum length of the obtained sequences used in further analysis was 559 bp; complete sequence of the cytochrome b gene (1140 bp) with the use of external (cet_cbF: aatgacatgaaaaat-catcgtt and cet_cbR: ctccttttccggtttacaa) and internal (beluga_cb_Fint: gtcattaccaatctcctatcagc and belu-ga_cb_Rint: gtttcgtgtaggaataataaatgg) primers. The combined sequence of the cytochrome b gene and the control region (1699 bp) was used in further analysis.

For DNA samples obtained from the remains of animals died from a few years to a few decades ago (samples from the coast of the Kara Sea), the follow-ing sequences were determined: 27 bp sequence of the tRNA-Pro gene and 464 bp sequence of the control region (total of 489 bp) using pairs of primers for amplification of short overlapping fragments: DNP1-F: accaccaacacccaaag and DNP3-tgtaagagcatgcatattatgt, DNP2-F: tacagtactacgtcag-tattaaataaa and DNP4-R: gggttgctggtttcacg, DNP7-cattcatttattttccatacg and DNP7-R: gttgctg-gtttcacgc, DNP5-F: tatactatggccgctcc and DNP6-R: tatttaaggggaacgagtgg; sequences of the fragments of the cytochrome b gene that included regions containing known parsi-mony-informative substitutions: positions 1–136 of the gene (beginning from the start codon, informative substitutions at the 75th and the 102nd positions), primers CNP1L-F: tcattattctcacatggtctct and CNP1L-R: ttgctaggaataagcctgtta, and positions 790– 976 of the gene (informative substitutions in 835th, 880th, and 894th positions), primers CNP2L-F: aggagacccagacaattaca and CNP2L-R: aggaaatctgcaat-taaagttc. In this case, the combined sequence (812 bp) of the control region and two regions of the cyto-chrome b gene was analyzed. During the phylogenetic analysis, the sequences obtained for all other samples and those known for the outgroups were restricted to a homologous region.

The individual sequences were combined, aligned, and prepared for the mathematical analysis using Bioedit v. 7.2.5 (Hall, 1999); the estimation of differ-ences in the haplotypes frequency in the samples (F_st) was performed in Arlequin v. 3.11 (Excoffier et al., 2005); the estimation of phylogenetic relationships was conducted by the Bayes algorithm implemented in MrBayes 3.2.6 (Ronquist and Huelsenbeck, 2003) with the use of the HKY+I+G model and sequences of the homologous regions of the mitochondrial genome of the narwhal (Monodon monoceros, Gen-Bank NC005279) and bottlenose dolphin (Tursiops truncatus, GenBank NC012059) as outgroups. The determination of the appropriate model was per-formed in MrModeltest2.3 (Nylander, 2004).

RESULTS AND DISCUSSION

White Sea. For 48 individuals studied, seven haplo-types of the combined 1699 bp region of mtDNA were revealed. Four of them include the same sequence of the control region that corresponds to the C425 (Gen-Bank JQ716356), or hp9 for a fragment of 409 bp (here and below, the abbreviations for the 409 bp control region sequences are in accordance with O’Corry- Crowe et al., 1997, 2010), but differ from each other by four variants of the sequence of the cytochrome b gene (cb07, cb10–12, GenBank MF919122–125). These sequences differ from each other by single nucleotide substitutions, but have a common pattern of the parsi-mony-informative substitutions, which correspond to the “Arctic” (c07) type of the sequence of this gene. In the total White Sea sample set, two original haplotypes of the control region, W479 and W747 (GenBank JQ716360–JQ716361), both in combination with the sequence of the cytochrome b gene cb07, and a haplo-type formed by a combination of a widespread S022 variant of the control region (GenBank HQ436320, hp5 as a 409 bp fragment) and cb01 (GenBank MF919129, “North-Pacific” type) sequence of the cytochrome b gene,were also noted.

In all investigated areas in the White Sea (mouth of the Varzuga River, Cape Beluzhiy, the whole Onezhs-kiy Bay, and Dvinskiy Bay), a single haplotype, which combines the sequences of cb07 (cytochrome b gene) and C425 (control region), was absolutely predomi-nant. Because of this, the haplotype diversity in the local sample sets was low (H = 0.400–0.553), and the differences between areas were defined as statistically insignificant.

Comparison of the composition of mitochondrial lineages of beluga whales of the White Sea with those in the nearest investigated region, Svalbard (O’Corry-Crowe et al., 2010), is possible only based on sequences of a 409 bp fragment of the control region. During the analysis, we also included data on five pre-viously studied belugas (O’Corry-Crowe et al., 2010) into our White Sea sample set.

In this comparison, the differences in haplotype occurence and frequency between belugas of the White Sea (five haplotypes) and Svalbard (seven hap-lotypes) were estimated as notably high, 15.82%, p < 0.0001. Two haplotypes, hp5 and hp9, which are widespread throughout the entire beluga range were common for the two sample sets. However, for the belugas from Svalbard, the sequences of the cyto-chrome b gene are unknown, while only in the White Sea the hp9 haplotype of the control region, as noted above, was found to be combined with the different sequences of this gene. It can be added that, for the hp5 (S022) haplotype of the control region, a combi-nation with different cytochrome b sequences is also known. For example, individuals with combination of S022 and cb14 (GenBank MF919130) were found in the Sea of Okhotsk. Thus, the registered level of differ-ences in composition of the mitochondrial lineages between belugas of Svalbard and the White Sea can, with future studies, prove to be even higher. The beluga whales inhabiting the White Sea should be unambiguously accepted as a spatially isolated group, at least from the Svalbard population. However, the degree of unity of recombining part of the genome (i.e. level of reproductive isolation) of belugas from the eastern Chukchi Sea (F_st = 21.87%) and Norton Sound (F_st = 37.39%). However, the minimal (unde-fined, 0.00%) differences in 409 bp control region haplotype occurence were found in comparison of sample sets from the Chukotka Peninsula coast and from the Beaufort Sea. This pattern is consistent with the results of the tracking of seasonal migrations of beluga whales in the North Pacific. It was shown that in the autumn–winter the Chukchi Peninsula is visited by belugas which spent a summer particularly in the Beaufort Sea, while the whales migrating into the Ber-ing Sea from the eastern Chukchi Sea in November– December follow the American coast (Citta et al., 2017). At the same time, the high similarity of sample sets from the coast of the Chukotka Peninsula and from the Beaufort Sea is associated with the predomi-nance of the hp9 variant of the control region in both groups, whereas data on the sequences of the cyto-chrome b gene for the extensive sample set from the Beaufort Sea are absent. Considering that this sequence of the control region was found to combine with two different variants of cytochrome b sequence (cb07 and cb09) even in a small sample set from the Chukotka coast, further investigation may demon-strate a greater isolation of beluga whales from off coast of the Chukchi Peninsula and the Beaufort Sea.

Central Russian Arctic. A 489 bp sequence of the mtDNA control region and two fragments of the cyto-chrome b gene, 136 and 187 bp, that include known parsimony-informative substitutions were obtained for each of the 21 samples studied. Among 21 com-bined individual sequences with a length of 812 bp, ten haplotypes were revealed. No association of the haplo-type occurrence with the place of origin of sample or the time of death of the animal was noted. Two out of these ten haplotypes (c07type of cytochrome b sequence and S425 control region haplotype and com-bination of c01type and S022) were also found both in the White Sea and in the BCB region, and two (c07-type-C925, coast of the Chukchi Peninsula and c01-type-hp8+, GenBank MF919106, Norton Sound) were thus far registered only in the BCB region. Six of the remaining haplotypes have not been previously found anywhere (Fig. 2). Three of these unique vari-ants, c01type-A003 (GenBank MF919058), c07type-A367 (single substitution in the cytochrome b sequence within the analyzed region), and c07type-hp38+ (GenBank MF919059), differ from the vari-ants c07type-C425 and c01type-S022 by single substi-tutions. Three remaining haplotypes, c07type-hp52+ (GenBank MF919062), c07type-hp41A+ (GenBank MF919060), and c07type-hp41B+ (GenBank MF919061), differ from other known variants by at least three nucleotide substitutions and form a sepa-rate clade on the phylogram (Fig. 2).

While examining the correspondence of the sequences of a 409 bp fragment of control region obtained by us and listed in the previously published studies (O’Corry-Crowe et al., 1997, 2010), it is important to note that three variants found in our Arc-tic sample set, hp38, hp52, and hp41 (differences between the haplotypes hp41A+ and hp41B+ are determined by substitutions outside the 409 bp region), are also known in beluga whales from Sval-bard, but not from other regions.

The short sequences of the mtDNA control region are insufficient for a satisfactory result of phylogenetic analysis. The additional use of the cytochrome b sequences made it possible to increase the phyloge-netic signal. In particular, the significant separation and monophyly of the Kamchatka phylogroup (in this study, it is represented by three sequences of beluga whales from the Anadyr Estuary) was confirmed. The haplotypes of this group (in addition to the uniqueness of the control region sequences) are united by the “Kamchatka” variant of the cytochrome b sequence (type c05, haplotypes cb05 and cb06, GenBank MF919131-32) characterized by three informative sin-gle nucleotide substitutions. It was also possible to confirm the separated position and monophyly of the “North Pacific” phylogroup, the sequences of which include the variant of cytochrome b gene of the c01 type (GenBank MF919129, MF919130, and others). The highest diversity of the haplotypes of this group is at present noted in the western Sea of Okhotsk; how-ever, a number of variants are also encountered in other regions, and the most frequently occurring sequence cb01-S022 can apparently be encountered along the entire range of the species.

The phylogenetic relationship between other sequences obtained by us remains unclear. All these sequences are united by the “Arctic” (c07) type of the cytochrome b gene (sequences cb07–cb13, GenBank MF919122–128), absent in the Sea of Okhotsk, but widely represented in the regions future north. The most common combination of cytochrome b and con-trol region sequences, cb07-C425, is apparently found throughout the Arctic part of the beluga whale range. It dominates, in particular, in our samples from the White Sea and the coast of the Chukchi Peninsula, and it was found in four out of 21 samples from the central part of the Eastern Arctic. However, the c07 type of the cytochrome b sequence by itself is not sufficient to prove the phylogenetic relationship between mito-chondrial genomes that include this sequence. On the phylogram (Fig. 2), some of these haplotypes form a separate clade, but with a very low support, whereas the position of others cannot be determined.

The c07 type of cytochrome b is also common for those haplotypes which include the 409 bp control region sequences found in the central part of the East-ern Arctic and in Svalbard, but not in the North Pacific and Western Arctic. As noted above, two (hp41 and hp52) or three (hp41A+, hp41B+, and hp52+, if we take a longer fragment of the control region) of these haplotypes differ from others by an original combination of substitutions that unites them into a separate clade with a high level of support (even with-out the involvement of data on the cytochrome b sequence). The phylogenetic position of this clade cannot be determined yet, but the distinction of these sequences from others and the fact that they are not found in the BCB region or off the coast of West Greenland allow for presumption that the Eastern Atlantic may be as an area of origin for this hap-logroup. In this case, it is possible that these sequences or those phylogenetically close to them will be found in larger numbers, at least in the western part of the Eastern Arctic (the Barents and Kara seas, waters off Franz-Josef Land and Novaya Zemlya) in the future.

Nevertheless, the presence in our Arctic sample set some haplotypes which are known for the coast of the Chukchi Peninsula and in the Bering Sea, as well as haplotypes spread across the global beluga range, does not allow to suggest a pronounced regional specificity for the total set of the mitochondrial lineages which occur in the central section of the Eastern Arctic. It is possible that, in the postglacial period, the region was colonized by belugas not only from the Atlantic, but also from the North Pacific, and the discontinuity of the species distribution range in the area of the East Siberian Sea is a recent phenomenon. Modern isola-tion of the groups of belugas occurring in various parts of the Eastern Arctic in different seasons can be inves-tigated only with the use of more extensive data.

In conclusion, it is possible to generalize that the beluga population in the White Sea is represented by a spatially isolated group, but the composition of mito-chondrial lineages of beluga whales of the Eastern Arctic in whole cannot be characterized as region-spe-cific.

ACKNOWLEDGMENTS

The authors are grateful to the management of the Mammal Genomic Resources Collection, University of Alaska Museum of the North for support of our query to provide samples for the analysis, LLC Utrish Dolphinarium for organization of the collection of samples in the mouth of the Varguza River. We are also grateful to those who personally collected samples for us or aided in the organization of their collection: A.A.Bystrov (Sopochnaya Karga polar station, Taimyr), I.A. Zagrebin (Beringia Natural–Ethnic Park), I.M. Okhlopkov (Institute for Biological Prob-lems of the Cryolithozone, Siberian Branch, Russian Academy of Sciences), and V.N. Svetochev (Mur-mansk Marine Biological Institute, Kola Science Center, Russian Academy of Sciences).

This work was supported by Russian Geographical Society (genetic analysis of the bone remains from the Arctic coast, as well as samples from the collection of University of Alaska and the sample set from the Anadyr Estuary), the International Fund for Animal Welfare (analysis of samples from Onezhskiy and Dvinskiy bays of the White Sea), the Program for Fun-damental Research of the Presidium of the Russian Academy of Sciences “Biodiversity of Natural Sys-tems” (analysis of the samples from the coast of the Chukchi Peninsula). Sample collection at the White Sea was supported by Russian State program 0149-2018-0008 (Shirshov Institute).

REFERENCES

Belikov, S.E., Boltunov, A.N., and Gorbunov, Y.A., Distri-bution and migrations of Cetaceans in Russian Arctic according to multiyear aerial reconnaissance of sea ice and information from “North Pole” drift station, in Morskie mlekopitayushchie (Rezul’taty issledovanii, provedennykh v 1995–1998 gg.) (Marine Mammals (Results of Research, 1995–1998)), Moscow: Sovet po morskim mlekopitayush-chim (Marine Mammal Council), 2002, pp. 21–51.

Berzin, A.A. and Yablokov, A.V., Numbers and population structure of the main exploited species of Cetaceans in the World Ocean, Zool. Zh., 1978, vol. 57, no. 12, pp. 1771– 1785.

Brown Gladden, J.G., Ferguson, M.M., and Clayton, J.W., Matriarchal genetic population structure of North Ameri-can beluga whales, Delphinapterus leucas (Cetacea: Mono-dontidae), Mol. Ecol., 1997, vol. 6, pp. 1033–1046.

Brown Gladden, J.G., Ferguson, M.M., Friesen, M.K., and Clayton, J.W., Population structure of North American beluga whales (Delphinapterus leucas) based on nuclear DNA microsatellite variation and contrasted with the pop-ulation structure revealed by mitochondrial DNA variation, Mol. Ecol., 1999, vol. 8, pp. 347–363.

Chernetsky, A.D., Belkovich, V.M., and Krasnova, V.V., New data on population structure of white whales in the White Sea, in Marine Mammals of Holarctic. The Second International Conference, Moscow: KMK, 2002, pp. 279– 282.

Citta, J.J., Richard, P., Lowry, L.F., O’Corry-Crowe, G., Marcoux, M., Suydam, R., Quakenbush, L.T., Hobbs, R.C., Litovka, D.I., Frost, K.J., Gray, T., Orr, J., Tinker, B., Aderman, H., and Druckenmiller, M.L., Satellite telemetry reveals population specific winter ranges of beluga whales in the Bering Sea, Mar. Mamm. Sci., 2017, vol. 33, no. 1, pp. 236–250.

Colbeck, G.J., Duchesne, P., Postma, L.D., Lesage, V., Hammill, M.O., and Turgeon, J., Groups of related belugas (Delphinapterus leucas) travel together during their seasonal migrations in and around Hudson Bay, Proc. Roy. Soc. Lon-don: B: Biol. Sci., 2013, vol. 280, no. 1752, p. 20122552.

Excoffier, L., Laval, G., and Schneider, S., Arlequin ver. 3.0: an integrated software package for population genetics data analysis, Evol. Bioinform. Online, 2005, vol. 1, pp. 47–50.

Hall, T.A., BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucl. Acids Symp. Ser., 1999, vol. 41, pp. 95–98.

Kleinenberg, S.E., Yablokov, A.V., Bel’kovich, V.M., and Tarasevich, M.N., Beluga (Delphinapterus leucas): Investi-gation of the Species, Jerusalem: Israel Program for Scientific Translations, 1969.

Kochnev, A.A., On migrations and seasonal distribution of the Beluga Whales (Delphinapterus leucas) in the Chukchi and East Siberian seas, Zool. Zh., 2003, vol. 82, no. 9, pp. 1112–1121.

Kuznetsova, D.M., Glazov, D.M., Shpak, O.V., and Rozh-nov, V.V., Winter distribution and migrations of beluga whales (Delphinapterus leucas) in the White Sea based on satellite tracking data, Biol. Bull. (Moscow), 2016, vol. 43, no. 8, pp. 914–918.

Lukin, L.R. and Ognetov, G.N., Morskie mlekopitayushchie rossiiskoi Arktiki. Ekologo-faunisticheskii analiz (Marine Mammals of the Russian Arctic. Ecological-Faunistic Analysis), Yekaterinburg: IEPS UrO RAN, 2009.

De March, B.G.E., Maiers, L.D., and Friesen, M.K., An overview of genetic relationships of Canadian and adjacent populations of belugas (Delphinapterus leucas) with empha-sis on Baffin Bay and Canadian eastern Arctic populations, NAMMCO Sci. Publ., 2002, vol. 4, pp. 17–38.

De March, B.G.E. and Postma, L.D., Molecular genetic stock discrimination of belugas (Delphinapterus leucas) hunted in eastern Hudson Bay, northern Quebec, Hudson Strait, and Sanikiluaq (Belcher Islands), Canada, and com-parisons to adjacent populations, Arctic, 2003, vol. 56, pp. 111–124.

Matishov, G.G. and Ognetov, G.N., Belukha Delphi-napterus leucas arkticheskikh morei Rossii: biologiya, ekologiya, okhrana i ispol’zovanie resursov (White Whale Delphinapterus leucas of the Russia Arctic Seas: Biology, Ecology, Protection and Exploitation of Resources), Apat-ity: Murmansk. Morsk. Biol. Inst. KNTs RAN (Murmansk Marine Biological Institute of Kola Science Centre of RAS), 2006.

Meschersky, I.G., Kholodova, M.V., and Zvychaynaya, E.Yu., Molecular genetic study of the beluga (Delphinapterus leu-cas: Cetacea, Monodontidae) summering in the southern Sea of Okhotsk as compared to North American popula-tions, Russ. J. Genet., 2008, vol. 44, no. 9, pp. 1105–1110.

Meschersky, I.G., Shpak, O.V., Litovka, D.I., Glazov, D.M., Borisova, E.A., and Rozhnov, V.V., A genetic analysis of the beluga whale Delphinapterus leucas (Cetacea: Monodonti-dae) from summer aggregations in the Russian Far East, Russ. J. Mar. Biol., 2013, vol. 39, no. 2, pp. 125–135.

Nylander, J.A.A., MrModeltest v2. Program Distributed by the Author, Evolutionary Biology Centre, Uppsala Univer-sity, 2004.

O’Corry-Crowe, G.M., Suydam, R.S., Rosenberg, A., Frost, K.J., and Dizon, A.E., Phylogeography, population structure and dispersal patterns of the beluga whale Delphi-napterus leucas in the western Nearctic revealed by mito-chondrial DNA, Mol. Ecol., 1997, vol. 6, pp. 955–970.

O’Corry-Crowe, G.M., Lydersen, C., Heide-Jørgensen, M.P., Hansen, L., Mukhametov, L.M., Dove, O., and Kovacs, K.M., Population genetic structure and evolutionary history of North Atlantic beluga whales (Delphinapterus leucas) from West Greenland, Svalbard and the White Sea, Polar Biol., 2010, vol. 33, pp. 1179–1194.

Ronquist, F. and Huelsenbeck, J.P., MRBAYES 3: Bayes-ian phylogenetic inference under mixed models, Bioinfor-matics, 2003, vol. 19, pp. 1572–1574.

Turgeon, J., Duchesne, P., Colbeck, G., Postma, L.D., and Hammill, M.O., Spatiotemporal segregation among sum-mer stocks of beluga (Delphinapterus leucas) despite nuclear gene flow: implication for the endangered belugas in eastern Hudson Bay (Canada), Conserv. Genet., 2012, vol. 13, pp. 419–433.